In the case of Erv25p, the decrease in protein level in an mutant was shown to be a consequence of a decrease in Erv25p protein stability and that Emp24p and Erv25p interact with one another in COPII-coated vesicles (Belden and Barlowe, 1996 ). and or gene inside a haploid segregant OPD2 of YPH274 (DHY9) using standard PCR techniques. Primer sequences were GAACAGATTGTTGGCGCTTTCTTCCTTATCGCCTCAATCTGA-AAGGATCTAGATTTGCCACGTTTTAAGAGCTTGGT and AT-TGAAACAACGAAATTCTCATGTATGCCTGCTAAGGATTCAATTTTTTGATATGTACGGTCGAGTTCAAGAGAAAA Trapidil (locus. The entire p24 ORF was exactly replaced in each case. The deletion of each gene was verified by PCR. Two times, triple, and quadruple p24 mutants were produced by PCR genotyping segregants from diploids generated by crossing haploid deletion strains. The mutation in CKY45 was back-crossed three times into the YPH274 genetic background to generate strain ARY63 suitable for crossing with the p24 deletion mutants. The locus in ARY63 was then genetically designated with by cloning a region of downstream flanking sequence (+884 to +1277 from ATG) into vector YEP352 (Hill locus by linearizing with marker allowed us to follow the locus in genetic crosses with the p24 deletion mutants individually of its temperature-sensitive phenotype. Overexpression of candida p24 genes was achieved by cloning each p24 ORF behind the triose phosphate isomerase (TPI) promotor inside a altered version of plasmid TPH (Dean and Pelham, 1990 ) in which the after cleavage with sec13-1 leu2-1 ura3-52 his ade2-101leu2-3,112 ura3-1 his3-11,15 trp1-1 ade2-1for 10 min and lysed by resuspension in 50 mM Tris-HCl, pH 7.5, and 0.1% Triton X-100. Samples corresponding to 1 1 OD600 unit of cells were electrophoresed on 8% nondenaturing polyacrylamide gels at 4C. Invertase was localized in gels after incubation in 0.1 M sodium acetate, pH 5.1, containing 0.1 M sucrose for 30C60 min at 30C as explained (Grossmann and Zimmermann, 1979 ). Preparation of Trapidil Protein Samples, Electrophoresis, and Immunoblotting To assay Gas1p transport, cells were cultivated to midlogarithmic phase, and 2 OD600 models were spun down and resuspended in 100 l of Laemmli sample buffer comprising 5 mM -mercaptoethanol. Glass beads were added, and the cells were lysed inside a bead beater (Biospec Products, Bartlesville, Okay). Lysates were boiled and loaded onto 8% SDS-polyacrylamide gels. After transfer to nitrocellulose membranes, blots were incubated with main and secondary antibodies, and bands were recognized using ECL (Amersham Trapidil Pharmacia Biotech, Uppsala, Sweden). Gas1p antiserum (provided by H. Riezman, University or college of Basel, Basel, Switzerland) was used at a 1:30,000 dilution. Goat anti-rabbit secondary antibody (promotor in or mutant cells produced at 30C in YPD. Exponentially dividing cells were washed and resuspended in new medium. Proteins of the tradition medium of 0.3 OD600 unit equivalents were TCA precipitated after 4.5 h and resolved by SDS-PAGE. Kar2p was recognized by Western blotting with anti-Kar2p antiserum. Protein components for the analysis of Emp24p, Erv25p, Erp1p, and Erp2p were prepared from 10 OD600 models of a log phase tradition resuspended in 300 l of 10% TCA. Cells were lysed by strenuous agitation in the presence of glass beads. Crude components were spun at maximum speed inside a Trapidil microcentrifuge, and the producing pellets were washed with chilly acetone. Pellets were resuspended in 200 l of Laemmli sample buffer comprising 5 mM -mercaptoethanol, and proteins were resolved on 12% polyacrylamide gels. Antisera to Emp24p (provided by H. Riezman) and Erv25p (provided by C. Barlowe, Dartmouth Medical School, Hanover, NH) were used at 1:5000 and 1:2000 dilutions, respectively. Antiporin mAb 16G9-E6 (Molecular Probes, Eugene, OR) was used at 0.5 g/ml. Erp1p antibodies were raised in rabbits to a C-terminal peptide (CQMKHLGKFFVKQKIL). Peptide was coupled via the N-terminal cysteine residue to keyhole limpet hemacyanin using maleimide (SMCC; to remove unbroken cells, and the supernatant (900 l) was transferred to 1.5-ml Eppendorf tubes. Triton X-100 was added to a 1%.